Sequence ID | >WENV170652528 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8771 |
End posion on genome | 8844 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cggtatccaa |
tRNA gene sequence |
TGGCCCATAGCTCAATGGCAGAGCAACCGCTTGATAAGCGGTCGACGATGGTTCGATTCC |
Downstream region at tRNA end position |
tccttcatgc |
Secondary structure (Cloverleaf model) | >WENV170652528 Ile GAT a ACCA tccttcatgc T + G G - C G - C C - G C - G C - G A - T T T T C T A C C A A A A | | | | | G T C T C G G A T G G C G | | | | T T G G A G C C A A CGAC A - T C - G C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |