Sequence ID | >WENV170652529 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8897 |
End posion on genome | 8972 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
caactgattt |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGCCAGAGCAGCGCTCTCGTAAAGCGAAGGCCGGAAGTTCGACT |
Downstream region at tRNA end position |
cggatcggcg |
Secondary structure (Cloverleaf model) | >WENV170652529 Thr CGT t ACCA cggatcggcg G - C C - G C - G G - C C - G C - G G - C T C T C C T T C A T G A A | | | | | G G C T C G G G A A G C G | | | | T T C G A G C C A A AGGCC G A C - G G - C C - G T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |