Sequence ID | >WENV170652531 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 9133 |
End posion on genome | 9208 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcccactcac |
tRNA gene sequence |
GAACCGGTAGCTCAGAGGCCAGAGCGGCGGACTTTTAATCCGAAGCGCGTGGGTTCGACT |
Downstream region at tRNA end position |
cgtctgccgc |
Secondary structure (Cloverleaf model) | >WENV170652531 Lys TTT c TCCA cgtctgccgc G - C A - T A - T C - G C - G G - C G - C T C T C A C C C A A G A A | | | | | G G C T C G G T G G G C G | | | | T T C G A G C C A G AGCGC G A C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |