Sequence ID | >WENV170652533 |
Genome ID | JRYH01005216 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1537 |
End posion on genome | 1611 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gggaacccgt |
tRNA gene sequence |
GCCGGGTTAGCTCAGCGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGGGGGTTCAATCC |
Downstream region at tRNA end position |
cccgcacgca |
Secondary structure (Cloverleaf model) | >WENV170652533 Thr TGT t ACCA cccgcacgca G - C C - G C - G G - C G - C G - C T - A C T T C T C C C A G A A | + | | | A C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |