Sequence ID | >WENV170652534 |
Genome ID | JRYH01005260 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4438 |
End posion on genome | 4514 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aaacaagtgt |
tRNA gene sequence |
CGGGGAATAGCTCAGCCTGGTAGAGCACTGCGTTCGGGACGCAGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
taaattcccg |
Secondary structure (Cloverleaf model) | >WENV170652534 Pro CGG t ACCA taaattcccg C - G G - C G - C G - C G - C A - T A - T T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |