Sequence ID | >WENV170652536 |
Genome ID | JRYH01005311 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4171 |
End posion on genome | 4081 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggcgggttcc |
tRNA gene sequence |
GGAGGGATGGATGAGCGGTTTAAGTCGCACGCCTGGAAAGCGTGTAAGGGTTAACAGCCC |
Downstream region at tRNA end position |
gttagattcc |
Secondary structure (Cloverleaf model) | >WENV170652536 Ser GGA c GCCA gttagattcc G - C G - C A - T G - C G - C G - C A - T T A T C C C C C A C G A G | | | | | G G G T A G G G G G G C G + | | T T T A G T C T T A G TAAGGGTTAACAGCCCTTC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |