Sequence ID | >WENV170652541 |
Genome ID | JRYH01005513 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7413 |
End posion on genome | 7338 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcccctatgt |
tRNA gene sequence |
GAGCCCGTAGCTCAGCCGGTAGAGCATCTGACTTTTAATCAGAGGGTCCCGGGTTCGAAT |
Downstream region at tRNA end position |
tctttgatcg |
Secondary structure (Cloverleaf model) | >WENV170652541 Lys TTT t ACCA tctttgatcg G - C A - T G - C C - G C - G C - G G - C T A T G G C C C A C G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |