Sequence ID | >WENV170652544 |
Genome ID | JRYH01005590 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 9176 |
End posion on genome | 9248 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggtttccacc |
tRNA gene sequence |
GGGGGCGTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
cgcgttcctt |
Secondary structure (Cloverleaf model) | >WENV170652544 Lys TTT c Attt cgcgttcctt G + T G - C G - C G - C G - C C - G G - C T G T C T C C C A T G A A | | | | G C C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |