Sequence ID | >WENV170652549 |
Genome ID | JRYH01005626 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1486 |
End posion on genome | 1575 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cccccgatgc |
tRNA gene sequence |
GGAGAGGTGCCGGAGCGGTCGAACGGGGCGGTCTCGAAAACCGTTGTGGGTGTGAGCCCA |
Downstream region at tRNA end position |
cttctatcag |
Secondary structure (Cloverleaf model) | >WENV170652549 Ser CGA c GCCA cttctatcag G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A C G A G | | | | | G G G G C C C A G G G C G | | | T T T A C G G C G A G TGTGGGTGTGAGCCCACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |