Sequence ID | >WENV170652558 |
Genome ID | JRYH01006084 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2582 |
End posion on genome | 2658 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcagcaaaaa |
tRNA gene sequence |
GCGCCCGTAGCTCATCTGGATAGAGTACCTGGCTACGAACCAGGGGGTAGGAGGTTCGAA |
Downstream region at tRNA end position |
gacannnnnn |
Secondary structure (Cloverleaf model) | >WENV170652558 Arg ACG a GCCA gacannnnnn G - C C - G G - C C - G C - G C - G G - C T A T C T T C C A C T A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A GGGTA C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |