Sequence ID | >WENV170652560 |
Genome ID | JRYH01006107 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3607 |
End posion on genome | 3532 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
acctttcctg |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCATGAATGGCATTCATGAGGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
ccctaaattt |
Secondary structure (Cloverleaf model) | >WENV170652560 Ala GGC g ACCA ccctaaattt G - C G - C G + T G - C C - G C - G G - C T A T T T C C C A T G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C G A G AGGTC C - G A - T T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |