Sequence ID | >WENV170652564 |
Genome ID | JRYH01006458 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4614 |
End posion on genome | 4538 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ccccgcaagc |
tRNA gene sequence |
GTCCCCGTAGCTCAGCTGGATAGAGCACAGGATTCCTAATCCTGGGGCCGTGGGTTCGAA |
Downstream region at tRNA end position |
gccgcagatg |
Secondary structure (Cloverleaf model) | >WENV170652564 Arg CCT c GCCA gccgcagatg G - C T - A C - G C - G C - G C - G G - C T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGCC C - G A - T G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |