Sequence ID | >WENV170652565 |
Genome ID | JRYH01006519 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7608 |
End posion on genome | 7526 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcgcactctg |
tRNA gene sequence |
GCCGGAGTGGCGGAATGGCAGACGCGGCGGATTCAAAATCCGCTTCTGGAAACAGAGTGA |
Downstream region at tRNA end position |
cgaaatgccc |
Secondary structure (Cloverleaf model) | >WENV170652565 Leu CAA g Aatg cgaaatgccc G - C C - G C - G G - C G - C A - T G - C T G T C T C C C A T A A G | | | | | G G G G C G G A G G G C G | | | T T C A C G C A G G TTCTGGAAACAGAGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |