Sequence ID | >WENV170652572 |
Genome ID | JRYH01006887 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5314 |
End posion on genome | 5239 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gctgtgcgat |
tRNA gene sequence |
AGGGGTGTAGCTCAATTGGCAGAGCGTCGGTCTCCAAAACCGAAGGCTGGGGGTTCGAGA |
Downstream region at tRNA end position |
tgaggttttg |
Secondary structure (Cloverleaf model) | >WENV170652572 Trp CCA t GCCA tgaggttttg A - T G - C G - C G - C G - C T - A G - C A G T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGCT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |