Sequence ID | >WENV170652574 |
Genome ID | JRYH01007069 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 449 |
End posion on genome | 533 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cttcccgcgt |
tRNA gene sequence |
GGAGGGATACCCAAGCGGTCAACGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGAA |
Downstream region at tRNA end position |
gtaatnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652574 Tyr GTA t ACCA gtaatnnnnn G - C G - C A - T G - C G - C G - C A - T T A T C T T C C A C G A A | | | | | G G A C C C G A A G G C G | | | T T T C G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |