Sequence ID | >WENV170652577 |
Genome ID | JRYH01007115 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1122 |
End posion on genome | 1198 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcgcggctct |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCCGGTAGCGCGCTTGCTTTGGGAGCAAGATGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
gctcaccccg |
Secondary structure (Cloverleaf model) | >WENV170652577 Pro TGG t ACCA gctcaccccg C - G G - C G - C G - C G - C T - A G - C T A T C T C C C A T G A A | + | | | G C C G C G G G G G G C C | | | | T T G G C G C G T A G ATGTC C - G T - A T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |