Sequence ID | >WENV170652584 |
Genome ID | JRYH01007202 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1520 |
End posion on genome | 1446 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccggacatcc |
tRNA gene sequence |
GGGCGATTGGCGCAGTTGGCTAGCGCACCAGTATGACACACTGGGGGTCACAGGTTCGAG |
Downstream region at tRNA end position |
cggtctctgc |
Secondary structure (Cloverleaf model) | >WENV170652584 Val GAC c ACtt cggtctctgc G - C G - C G - C C - G G - C A - T T - A T G T T G T C C A T G A G | | | | | G T C G C G A C A G G C G | | | | T T G G C G C C T A A GGGTC C - G C - G A - T G - C T - A A C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |