Sequence ID | >WENV170652593 |
Genome ID | JRYH01007707 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 122 |
End posion on genome | 47 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atctgaatcc |
tRNA gene sequence |
GGGCCCGTAGTTCAGTGGTCAGAACGCGCCGCTCATAACGGTGTTGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
gccttcgctc |
Secondary structure (Cloverleaf model) | >WENV170652593 Met CAT c ACCA gccttcgctc G - C G - C G - C C - G C - G C - G G - C T A T C G T C C A T G A A | | | | | G G C T T G G C A G G C G | | | | T T T G A A C C A G TTGTC C - G G + T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |