Sequence ID | >WENV170652594 |
Genome ID | JRYH01007799 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1 |
End posion on genome | 86 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGAGGGGTGCCCGAGTGGCTAAAGGGGGCAGACTGTAAATCTGTTGGCTTACGCCTACGT |
Downstream region at tRNA end position |
gttggccggt |
Secondary structure (Cloverleaf model) | >WENV170652594 Tyr GTA n ACCA gttggccggt G - C G - C A - T G - C G + T G - C G - C T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G T A A G TGGCTTACGCCTAC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |