Sequence ID | >WENV170652598 |
Genome ID | JRYH01007989 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2567 |
End posion on genome | 2643 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgggctcggc |
tRNA gene sequence |
GGTGATGTAGCTCAGACGGTTAGAGCGATGGATTCATAACCCATAGGTCGGCGGTTCGAT |
Downstream region at tRNA end position |
acgaattcaa |
Secondary structure (Cloverleaf model) | >WENV170652598 Met CAT c ACCA acgaattcaa G - C G - C T - A G - C A - T T - A G - C T T T C C G C C A A G A A | | | | | G C C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC A - T T - A G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |