Sequence ID | >WENV170652600 |
Genome ID | JRYH01008095 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1526 |
End posion on genome | 1601 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tcaggattgc |
tRNA gene sequence |
GCCGCTTTAGCTCAGTCGGTAGAGCAACCGCTTCGTAAGCGGTAGGTCATCTGTTCGAGT |
Downstream region at tRNA end position |
tctacaaggc |
Secondary structure (Cloverleaf model) | >WENV170652600 Thr CGT c ACCA tctacaaggc G - C C - G C - G G - C C - G T - A T - A T G T T A G A C A T G A A | | | | | G C C T C G A T C T G C G | | | | T T G G A G C T A A AGGTC A - T C - G C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |