Sequence ID | >WENV170652601 |
Genome ID | JRYH01008147 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 16088 |
End posion on genome | 16016 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gctgcgtggt |
tRNA gene sequence |
GCCACCTTAGCTCAGTCGGTAGAGCGAAGCTTTCGTAAAGCTTAGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
cgtgatccga |
Secondary structure (Cloverleaf model) | >WENV170652601 Thr CGT t Tttt cgtgatccga G - C C - G C - G A - T C - G C - G T - A T G T C G C T C A T G A A | | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC A - T A - T G - C C - G T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |