Sequence ID | >WENV170652602 |
Genome ID | JRYH01008291 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12830 |
End posion on genome | 12905 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggcgcccgtt |
tRNA gene sequence |
GCCGGCATAGCTCAGTTGGTAGAGCAGCGCACTTGTAATGCGAAGGTCGGGGGTTCGACT |
Downstream region at tRNA end position |
gatttcgaag |
Secondary structure (Cloverleaf model) | >WENV170652602 Thr TGT t ACCA gatttcgaag G - C C - G C - G G - C G - C C - G A - T T C T T C T C C A T G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |