Sequence ID | >WENV170652603 |
Genome ID | JRYH01008291 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12983 |
End posion on genome | 13059 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtttctccga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
aacaaagcag |
Secondary structure (Cloverleaf model) | >WENV170652603 Met CAT a ACCA aacaaagcag C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |