Sequence ID | >WENV170652604 |
Genome ID | JRYH01008403 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2833 |
End posion on genome | 2759 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgccctgagt |
tRNA gene sequence |
CTCGTCATAGTTCAATGGATAGAACGGGCGCCTCCTAAGCGCCAGATCCAGGTTCGATTC |
Downstream region at tRNA end position |
cttcaaagca |
Secondary structure (Cloverleaf model) | >WENV170652604 Arg CCT t ACCA cttcaaagca C - G T + G C - G G - C T - A C - G A - T T T T G G T C C A T A A A | | | | | G G C T T G C C A G G C G | | | | T T A G A A C T A G AGAT G - C G - C C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |