Sequence ID | >WENV170652607 |
Genome ID | JRYH01008576 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 736 |
End posion on genome | 812 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tttcccgagt |
tRNA gene sequence |
GGGGATGTAGCTCAGCCTGGGAGAGCGCCGCGTTCGCAACGCGGAGGTCGAGGGTTCGAT |
Downstream region at tRNA end position |
gtaataccaa |
Secondary structure (Cloverleaf model) | >WENV170652607 Ala CGC t ACCA gtaataccaa G - C G - C G + T G - C A - T T - A G - C T T T T T C C C A C G A A + | | | | G C C T C G G A G G G C T | | | | T T G G A G C G G A G AGGTC C - G C - G G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |