Sequence ID | >WENV170652608 |
Genome ID | JRYH01008631 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2531 |
End posion on genome | 2622 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgccgctccc |
tRNA gene sequence |
GGAGAGGTGGATGAGTGGTTGAAATCGCACGCCTGGAAAGCGTGTTCAGGGTTTACGCCC |
Downstream region at tRNA end position |
cgaatccagt |
Secondary structure (Cloverleaf model) | >WENV170652608 Ser GGA c GCCA cgaatccagt G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G T A G G C G G G C G | | | T T T A A T C T G A G TTCAGGGTTTACGCCCTGAC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |