Sequence ID | >WENV170652610 |
Genome ID | JRYH01008942 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3698 |
End posion on genome | 3623 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
agcacccaga |
tRNA gene sequence |
GCGGCAGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGAGAGTTCGAGA |
Downstream region at tRNA end position |
ttcccccttc |
Secondary structure (Cloverleaf model) | >WENV170652610 Gly GCC a TCCA ttcccccttc G - C C - G G - C G - C C - G A - T G - C A G T T T C T C A T G A A + | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |