Sequence ID | >WENV170652611 |
Genome ID | JRYH01008942 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3612 |
End posion on genome | 3536 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttcccccttc |
tRNA gene sequence |
GCGTCCTTAGCTCAGCTGGTTAGAGCGCCACGTTGACATCGTGGAGGTCGGCGGTTCGAT |
Downstream region at tRNA end position |
ggcgcttcgc |
Secondary structure (Cloverleaf model) | >WENV170652611 Val GAC c ACCA ggcgcttcgc G - C C - G G - C T - A C - G C - G T - A T T T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |