Sequence ID | >WENV170652613 |
Genome ID | JRYH01009118 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6527 |
End posion on genome | 6604 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taaatctgtg |
tRNA gene sequence |
GTGGGTGTAGCTCAGACCGGTTAGAGCACTGGGTTGTGGCCCCAGAGGTCGCGGGTTCAA |
Downstream region at tRNA end position |
ccttaccagc |
Secondary structure (Cloverleaf model) | >WENV170652613 His GTG g CCCA ccttaccagc G - C T - A G - C G + T G - C T - A G - C T A T T G C C C A C A G A A + | | | | A C C T C G G C G G G C G | | | | T T G G A G C T T A A AGGTC C - G T - A G - C G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |