Sequence ID | >WENV170652615 |
Genome ID | JRYH01009172 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2810 |
End posion on genome | 2886 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcgcgtcctc |
tRNA gene sequence |
CGGGGCGTAGCTCAGCCTGGTAGAGTGCTTGCTTTGGGAGCAAGATGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
cgttgttccc |
Secondary structure (Cloverleaf model) | >WENV170652615 Pro TGG c ACCA cgttgttccc C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | + T T G G A G T G T A G ATGTC C - G T - A T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |