Sequence ID | >WENV170652620 |
Genome ID | JRYH01009281 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4346 |
End posion on genome | 4441 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gagagcgctc |
tRNA gene sequence |
GGAGGCGTTTAGGTTCCTGGTGGTCCTCCCGGTCTTCAAAACCGGTGAGACCGAGTAGCT |
Downstream region at tRNA end position |
atcgctgcaa |
Secondary structure (Cloverleaf model) | >WENV170652620 SeC(p) TCA c GCCA atcgctgcaa G - C G - C A - T G - C G - C C - G G - C T C T T T T G T C C A C C T T + | | | | G T T G G A G C A G G C G | | | T T G T C C T T G G C TGAGACCGAGTAGCTCGGTCTG C - G C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |