Sequence ID | >WENV170652621 |
Genome ID | JRYH01009426 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12904 |
End posion on genome | 12818 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgtgtgcttt |
tRNA gene sequence |
GCCCCTGTGGCGGAATCGGTAGACGCGGCAGACTCAAAATCTGTTGCTGGCAACAGCGTG |
Downstream region at tRNA end position |
ccttccagac |
Secondary structure (Cloverleaf model) | >WENV170652621 Leu CAA t ACCA ccttccagac G - C C - G C - G C - G C - G T - A G - C T G T C G G G C A T A A G | | | | | G C G G C G G C C C G C G | | | T T G A C G C T A G G TGCTGGCAACAGCGT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |