Sequence ID | >WENV170652634 |
Genome ID | JRYH01010215 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1748 |
End posion on genome | 1672 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tcgcttctgc |
tRNA gene sequence |
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ccattcgaag |
Secondary structure (Cloverleaf model) | >WENV170652634 Arg ACG c GCCA ccattcgaag G - C C - G G - C G - C C - G T - A G - C T A T C G T C C A T G A A | + + | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |