Sequence ID | >WENV170652635 |
Genome ID | JRYH01010430 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 925 |
End posion on genome | 849 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggtcttcagc |
tRNA gene sequence |
AGGCGCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
agattctgga |
Secondary structure (Cloverleaf model) | >WENV170652635 Val GAC c ACCA agattctgga A - T G - C G - C C - G G - C C - G G - C T A T T A A C C A T G A A + | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |