Sequence ID | >WENV170652642 |
Genome ID | JRYH01010629 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 314 |
End posion on genome | 390 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ccgacttttc |
tRNA gene sequence |
CGGGGTGTAGCGTAGTCTGGTAGCGCGCCTGGTTTGGGACCAGGATGTCGGGAGTTCAAA |
Downstream region at tRNA end position |
attttcgtgt |
Secondary structure (Cloverleaf model) | >WENV170652642 Pro TGG c ACCA attttcgtgt C - G G - C G - C G - C G - C T - A G - C T A T C T C T C A T G A A | + | | | A C T G C G G G G A G C T + | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |