Sequence ID | >WENV170652644 |
Genome ID | JRYH01010674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4165 |
End posion on genome | 4247 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gtaccacgga |
tRNA gene sequence |
GGGGAGGTGGCTGAGCGGTCAAAAGCAGCAGACTGTAAATCTGCCGGTGCAAGCCTACGT |
Downstream region at tRNA end position |
cactaatatg |
Secondary structure (Cloverleaf model) | >WENV170652644 Tyr GTA a Atgg cactaatatg G - C G - C G - C G - C A - T G - C G - C T A T C G T C C A C G A G | + | | | G G G T C G G T A G G C G | | | T T T A A G C C A A A CGGTGCAAGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |