Sequence ID | >WENV170652645 |
Genome ID | JRYH01010674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4327 |
End posion on genome | 4401 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cgcattccag |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGCTAGAGCATCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
aggattcaca |
Secondary structure (Cloverleaf model) | >WENV170652645 Gly TCC g TCat aggattcaca G - C C - G G - C G - C G - C A - T G - C T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |