Sequence ID | >WENV170652646 |
Genome ID | JRYH01010674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4414 |
End posion on genome | 4489 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aggattcaca |
tRNA gene sequence |
GCCCACGTAGCTCAGCCGGCAGAGCACATCCTTGGTAAGGATGAGGTCAGCGGTTCAAGT |
Downstream region at tRNA end position |
cttgctatct |
Secondary structure (Cloverleaf model) | >WENV170652646 Thr GGT a TCCA cttgctatct G - C C - G C - G C - G A - T C - G G - C T G T T C G C C A C G A A | | | | | A C C T C G A G C G G C G | | | | T T G G A G C C A A AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |