Sequence ID | >WENV170652651 |
Genome ID | JRYH01011180 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1913 |
End posion on genome | 1988 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cagcaccgca |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGATAACCGGGGTTCGAAT |
Downstream region at tRNA end position |
tacaaggcgt |
Secondary structure (Cloverleaf model) | >WENV170652651 Glu TTC a GCCA tacaaggcgt G - C T - A C - G C - G C - G C - G A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A TAAC C A C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |