Sequence ID | >WENV170652653 |
Genome ID | JRYH01011267 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1986 |
End posion on genome | 2060 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cggcacggat |
tRNA gene sequence |
GGGCACTTAGCTCAGCGGTAGAGCACTACCTTGACATGGTAGGGGTCAGAGGTTCGATCC |
Downstream region at tRNA end position |
tccgcgcacc |
Secondary structure (Cloverleaf model) | >WENV170652653 Val GAC t ACCA tccgcgcacc G - C G - C G - C C - G A - T C - G T - A C T T T C T C C A G A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |