Sequence ID | >WENV170652658 |
Genome ID | JRYH01011978 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1877 |
End posion on genome | 1951 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aattttttga |
tRNA gene sequence |
GGGCCCATAGCTCAGTTGGTTAGAGCGACGGACTCATAATCCGTTGGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
ataaagcttt |
Secondary structure (Cloverleaf model) | >WENV170652658 Met CAT a ACac ataaagcttt G - C G - C G - C C - G C - G C - G A - T T G T G G G C C A T G A A | | + | | G T C T C G C C T G G C G | | | | T T G G A G C T T A G TGGTC A - T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |