Sequence ID | >WENV170652664 |
Genome ID | JRYH01012454 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 472 |
End posion on genome | 396 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctcctatgg |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTGAGAGCGCAGGATTCATAACCCTGAGGTCGGGAGTTCAAA |
Downstream region at tRNA end position |
gttgatttca |
Secondary structure (Cloverleaf model) | >WENV170652664 Met CAT g ACCA gttgatttca G + T G - C C - G G - C G - C G - C G - C T A T C C C T C A T G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T G A G AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |