Sequence ID | >WENV170652666 |
Genome ID | JRYH01012660 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3152 |
End posion on genome | 3225 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ggcgacagac |
tRNA gene sequence |
GCCTCCCTAGCTCAATCGGTAGAGCAGCTGACTCTTAATCAGCGGGTTTCAGGTTCGAGT |
Downstream region at tRNA end position |
tcacaagccc |
Secondary structure (Cloverleaf model) | >WENV170652666 Lys CTT c ACtt tcacaagccc G + T C - G C - G T + G C - G C - G C - G T G T A G T C C A T A A A | | | | | G C C T C G T C A G G C G | | | | T T G G A G C T A A GGGTT G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |