Sequence ID | >WENV170652670 |
Genome ID | JRYH01013013 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1200 |
End posion on genome | 1126 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaatgtggat |
tRNA gene sequence |
AGGGCAGTAGCTCAATTAGGGAGAGCACTGGACTCCAAATCCAGCGGTTGGGGGTTCGAT |
Downstream region at tRNA end position |
aggacacccg |
Secondary structure (Cloverleaf model) | >WENV170652670 Trp CCA t GCac aggacacccg A - T G - C G - C G - C C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C A | | | | T T G G A G C G G A A CGGTT C - G T - A G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |