Sequence ID | >WENV170652671 |
Genome ID | JRYH01013151 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 716 |
End posion on genome | 800 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcgggtggcc |
tRNA gene sequence |
GGACGCGTGCCCGAGTGGACTAAGGGGGCGGATTGCAAATCCGTTTGGGGAAACCCAGTC |
Downstream region at tRNA end position |
atgccgggcc |
Secondary structure (Cloverleaf model) | >WENV170652671 Cys GCA c Tttg atgccgggcc G - C G - C A - T C - G G - C C - G G - C T A T C A G C C A T G A G | | | | | G G G C C C G T C G G C G | | | T T A A G G G C T A G TTGGGGAAACCCAGTC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |