Sequence ID | >WENV170652672 |
Genome ID | JRYH01013168 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1427 |
End posion on genome | 1501 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gcatccggtc |
tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGAGAGTTCAATCC |
Downstream region at tRNA end position |
ttnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652672 Thr GGT c ACCA ttnnnnnnnn G - C C - G T - A G - C C - G C - G G + T C T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |