Sequence ID | >WENV170652675 |
Genome ID | JRYH01013387 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1135 |
End posion on genome | 1060 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgctctttca |
tRNA gene sequence |
GGGCCGATAGCTCAGCTGGGAGAGCGCTGCGTTCGCAATGCAGAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
atttcaaaag |
Secondary structure (Cloverleaf model) | >WENV170652675 Ala CGC a ACCA atttcaaaag G - C G - C G + T C - G C - G G - C A - T C T T T C C T C A C G A A + | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC C - G T - A G - C C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |