Sequence ID | >WENV170652677 |
Genome ID | JRYH01013758 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 843 |
End posion on genome | 919 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaaggtttct |
tRNA gene sequence |
TGGGGAGTCGCCAAGTTGGTCAAGGCACCGGATTTTGATTCCGGCATTCGAAGGTTCGAA |
Downstream region at tRNA end position |
cacaacgaag |
Secondary structure (Cloverleaf model) | >WENV170652677 Gln TTG t GCCA cacaacgaag T - A G - C G + T G - C G - C A - T G - C T A T C T T C C A T G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T C A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |