Sequence ID | >WENV170652679 |
Genome ID | JRYH01013768 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 449 |
End posion on genome | 525 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaggtttcat |
tRNA gene sequence |
TGGGGAGTCGCCAAGTCGGTTAAGGCACCGGATTTTGATTCCGGCATTCGAGGGTTCGAA |
Downstream region at tRNA end position |
tacaacgacg |
Secondary structure (Cloverleaf model) | >WENV170652679 Gln TTG t GCCA tacaacgacg T - A G - C G - C G - C G - C A - T G - C T A T C T T C C A T G A C | | + | | G C A C C G G A G G G C G | | | T T G A G G C T T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |